9. Find the restriction sites and "cut" the DNA in the sequence below. How many...

70.2K

Verified Solution

Question

Biology

image

9. Find the restriction sites and "cut" the DNA in the sequence below. How many bands ofDNA would you see on the electrophoresis gel?BamI (CCT'AGG) --- 5' CCTAG G 3'; EcoRI (GAATTC) --- 5' GAATTC 3'3'5' ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA3'TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5'

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students