3 Given the guiding region of a single guide RNA sgRNA and the double stranded...

70.2K

Verified Solution

Question

Biology

image

3 Given the guiding region of a single guide RNA sgRNA and the double stranded DNA dsDNA in the following picture Guiding region AACGGGCGCUGGGUCGGUUA Target dsDNA TGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAG ACCACGTTGCCCGCGACCCAGCCAATGCCGGTCCTGTC a Highlight the sequence in the target dsDNA which is specifically recognized by the sgRNA b In the dsDNA indicate the region where Cas9 would cut the target dsDNA 45 X bi lactose X y plasmid ot 0 1 1 10 lac 2 of mutation

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students