1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats...

50.1K

Verified Solution

Question

Biology

1. Princess eats 60g of oats for breakfast before her biologyexam. Each gram of oats contains three (3) molecules ofglucose.
a. Assuming Princes uses 180 molecules of adenosinetriphosphate in consuming breakfast and cleaning up afterbreakfast, calculate the net ATP Princes has from breakfast for hermorning activities. ​​​​​​​​
b. Describe how Princess generates the net energy from ATP bysubstrate level phosphorylation for her biology exam. ​​​​​
c. State the total number of ATP generated from oxidativephosphorylation. Describe how this number is generated. ​​​​​​​

2. You have been given a DNA fragment obtained from the genomeof Bacillus thuringiensis below:
3’CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5’

Additional tools are provided below.

a. Provide the complementary strand for the parent strand(above) that would be synthesized during replication of the linearDNA fragment ​​
b. List the enzymes involved in this DNA replication ​​​
c. Use the parent strand as a template to synthesize mRNAstrand. Describe how the mRNA strand is generated and regulated.Indicate the direction of synthesis.


d. Synthesize a polypeptide from the mRNA.​​​​
TOOLS:

a. Primer: GUGAUU
b. Codon table







Answer & Explanation Solved by verified expert
4.3 Ratings (1046 Votes)
    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students