1 Primers and Base pairing 3 points Primers are usually approximately 20 nucleotides long For...
90.2K
Verified Solution
Link Copied!
Question
Biology
1 Primers and Base pairing 3 points Primers are usually approximately 20 nucleotides long For this activity we will use a 5 base pair primer Using this primer 5 GATAC 3 Show where the primer binds to your template DNA below Indicate the primer by using bold text Then act as the polymerase and fill in the rest of the new strand of DNA DNA polymerase can only add to the 3 M end of the new DNA strand New DNA strand Template DNA 3 3 TAGCTATGCGGACCTCATGCATTAGAGTA G 5 5
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
