1. Please explain how the sequence of events that occurs when acodon that specifies an amino acid enters a ribosome's A sitediffers from the sequence of events that occurs when a stop codonenters a ribosome's A site.
2. Below is the base sequence of the template strand of DNA.Please answer the following questions based upon this DNAsequence:
3’–ACTACACGACAGGCATAATT—5’ (DNA Template)
a. What is the base sequence of the non-template (coding) strandof DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on thetemplate strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the templatestrand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptideproduced from the RNA strand from (c)? (2 pts.)



