1. Please explain how the sequence of events that occurs when a codon that specifies an...

60.2K

Verified Solution

Question

Biology

1. Please explain how the sequence of events that occurs when acodon that specifies an amino acid enters a ribosome's A sitediffers from the sequence of events that occurs when a stop codonenters a ribosome's A site.

2. Below is the base sequence of the template strand of DNA.Please answer the following questions based upon this DNAsequence:

3’–ACTACACGACAGGCATAATT—5’ (DNA Template)

a. What is the base sequence of the non-template (coding) strandof DNA? (1 pt.)
b. In which direction (left or right) would the promoter lie on thetemplate strand? Why? (2 pts.)
c. What is the RNA sequence that would be produced by the templatestrand? (1 pt.)
d. What would be the sequence of amino acids in the polypeptideproduced from the RNA strand from (c)? (2 pts.)




Answer & Explanation Solved by verified expert
4.0 Ratings (407 Votes)
1 Translation is the process of converting an mRNA transcript into a proteinor a polypeptide with the help of ribosomes and amino acid carrying tRna It takes place in the cytoplasm of the cell in eukaryotes and in the nucleoid region of the prokaryotes Ribosome containing 2 subunitslarge and small has three sites by which it mediates the elongation of the polypeptide chain they are A P and E sites The following events takes place when a    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students