1) Given your understanding of transcription and translation,fill in the items below with the proper sequences. Please alignyour answers under the nontemplate DNA strand. Ignore RNA stopcodons if they are present.

Nontemplate strand ofDNA:                5′- A T G T A T G C C A A T G C A -3′

     Template strand ofDNA:       

                                RNA:       

            Anticodons on tRNA:      

           Amino acid sequence:

2) Original template strand of DNA:  3′- T A C G C A A G C A A TA C C G A C G A A -5′

a. Transcribe this sequence:

                                     RNA:

b. Translate the RNA sequence. Ignore start/stop codons ifpresent.

                Amino acid sequence:

3) The table below lists five single-base point mutations thatmay occur in DNA. What happens to the amino acid sequence as aresult of each mutation? (Position 1 refers to the first base atthe 3′ end of the DNA strand. Position 21 would refer to the lastbase at the 5’ end.). Note that amino acids are numbered from L à Ras 1-7.

Original template strand:  3’ TACGCAAGCAATACCGACGAA 5’

                  RNA strand:

     Amino acidsequence:                                                           (number aa’s 1-7 L-R)

Mutation	Effect on amino acid sequence. Write ~3 amino acids around themutation site to show a tripeptide sequence with the change.Indicate the aa numbers of the new tripeptide.
i. Substitution of T for G at position 8.
ii. Addition of T between positions 8 and 9.
iii. Deletion of C at position 15.
iv. Substitution of T for C at position 18.
v. Deletion of C at position 18.
vi.   Which of the mutations above produces thegreatest change in the amino acid sequence of the polypeptide codedfor by this 21-base-pair gene? That is, which will have the largesteffect on structure? Why is this?