1. Explain how RNAi could be used to treat disease. 2. What are two specific ways...

60.1K

Verified Solution

Question

Biology

1. Explain how RNAi could be used to treat disease.
2. What are two specific ways in which RNAi can block theproduction of proteins.
3. RNAi exerts its effect by mainly controlling whichprocess?
a. Termination
b. Translation
c. Transcription
d. Replication
e. Splicing
4. Which of the following is not true about miRNA?
a. One miRNA may match multiple targets
b. miRNA is used by scientist as a therapy
c. miRNA is found in plants and animals
d. miRNA is a product of a gene
5. An RNA molecule that loops to base pair with itself is calleda.............. RNA because of its characteristic shape.
6. Suppose that you wish to target a gene using siRNA. The sensestrand of the gene that is the DNA strand codes for the mRNAcontains 21 base sequence: 5' TCGGAGCAAATAGGTAGGCA 3' What would bethe most appropriate 21 base guide strand sequence that wouldtarget the mRNA?

Answer & Explanation Solved by verified expert

4.2 Ratings (508 Votes)

1 RNAi is thought to be a natural defense mechanism that has evolved for the protection of organisms from RNA viruses Cells can recognize double stranded RNA dsRNA as an intruder When this happens the enzyme Dicer is recruited to cut the foreign RNA See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member