1. During the process of electrophoresis, the ________ functions like a molecular sieve, separating the samples...

60.1K

Verified Solution

Question

Biology

1. During the process of electrophoresis, the ________ functionslike a molecular sieve, separating the samples according to theirsize.
A) agarose gel
B) sample mixture
C) positively charged electrode
D) negatively charged electrode
2. The restriction enzyme SacI has a recognition sequence ofGAGCT^C, where the caret (^) indicates the cut site. Examine theDNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if youtreated the above DNA molecule with SacI?
A) four
B) three
C) five
D) two
3. The restriction enzyme BamHI recognizes the DNA sequenceGGATCC and always cuts between the two G nucleotides. How manybases long is the sticky end of a DNA molecule that has been cutwith BamHI?
A) four
B) three
C) five
D) two

Answer & Explanation Solved by verified expert

3.6 Ratings (419 Votes)

1Option A Agarose is a component of agar which is produced after removal of agaropection from the agar It is extracted from an algal species called as red seaweed It consists of monomers of agarobiose Agarose is commercially available for electrophoresis experiments See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member